| 產品名稱 | Yarrowia lipolytica (Wickerham et al.) van der Walt et von Arx |
|---|---|
| 商品貨號 | B220612 |
| Deposited As | Endomycopsis lipolytica Wickerham et al. |
| Strain Designations | IFP29 [CBS 7504, W29, CLIB 89] |
| Synonym | Endomycopsis lipolytica Wickerham et al., Saccharomycopsis lipolytica (Wickerham et al.) Yarrow |
| Alternate State | Candida lipolytica (Harrison) Diddens et Lodder |
| Application | Produces citric acid citrate
Produces isocitric acid isocitrate |
| Biosafety Level | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format | freeze-dried |
| Storage Conditions | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain | no |
| Disclosure | This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished. This material may not have been produced or characterized by ATCC. |
| Preceptrol® | no |
| Genome Sequenced Strain | Yes |
| Mating Type | mating type A, mates with ATCC 18944
Ref  Gaillardin CM, et al. A study of copulation, sporulation and meiotic segregation in Candida lipolytica. Arch. Mikrobiol. 92: 69-83, 1973. PubMed: 4725824 |
| Comments | Aconitase Genome sequencing strain (Genolevures Consortium, France). |
| Morphology | After 5 days on YM media colonies butyrous to mycelial and tannish-white in color. Cells are spheroidal, ellipsoidal to elongate and single, in pairs or small clusters. Pseudohyphae and true hyphae are usually present. |
| Medium | ATCC® Medium 200: YM agar or YM broth ATCC® Medium 1245: YEPD ATCC® Medium 28: Emmons' modification of Sabouraud's agar |
| Growth Conditions | Temperature: 20°C to 25°C
Atmosphere: Typical aerobic |
| Sequenced Data |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
TTGATTTTATCTATTTCTGTGGATTTCTGGTATATTACAGCGTCATTTTATCTCAATTATAACTATCAACAACGGATCTCTTGGCTCTCACATCGATGAAGAACGCAGCGAACCGCGATATTTTTTGTGACTTGCAGATGTGAATCATCAATCTTTGAACGCACATTGCGCGGTATGGCATTCCGTACCGCACGGATGGAGGAGCGTGTTCCCTCTGGGATCGCATTGCTTTCTTGAAATGGATTTTTTTAAACTCTCAATTATTACGTCATTTCACCTCC D1D2 region of the 28S ribosomal RNA gene ACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAACCCTCGGGATTGTAATTTGAAGATTTGGCATTGGAGAAAGCTAACCCAAGTTGCTTGGAATAGTACGTCATAGAGGGTGACAACCCCGTCTGGCTAACCGTTCTCCATGTATTGCCTTATCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAACTCCATCTAAAGCTAAATACTGGTGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGGTGAAAAGAACTTTGAAAAGAGAGTGAAATAGTATGTGAAATTGTTGATAGGGAAGGAAATGAGTGGAGAGTGGCCGAGGTTTCAGCCGCCCCTCGTGGGCGGTGTACTGCCGACGCCGAGTCATCGATAGCGAGACGAGGGTTACAAATGGGAGCGCCTTCGGGCGTTCTCCCCTAACCCTCCACACTGCCACCGACGACATAAT |
| Name of Depositor | C Gaillardin |
| U.S. Patent Number | |
| Isolation | Soil |
| Cross References | Nucleotide (GenBank) : KU729095 ITS including 5.8S rRNA gene Nucleotide (GenBank) : X65225 Y.lipolytica PHO2 gene for acid phosphatase. Nucleotide (GenBank) : AJ006754 Yarrowia lipolytica URA5-SEC65 gene region. Nucleotide (GenBank) : Z34956 Y.lipolytica HOY1 gene for DNA-binding protein. Nucleotide (GenBank) : Z49114 Y.lipolytica LYS1 gene for homocitrate synthase. Nucleotide (GenBank) : Z22571 Y.lipolytica orotate phosphoribosyl transferase gene. Nucleotide (GenBank) : Z23265 Y.lipolytica CRF1 gene encoding product required for copper. Nucleotide (GenBank) : Z22570 Y.lipolytica signal recognition particle protein (SRP19) gene. Nucleotide (GenBank) : Z46872 Y.lipolytica gene for exo-1,3-beta-glucanase/1,3-beta-D-glucan. Nucleotide (GenBank) : Z23264 Y.lipolytica MTP1 and MTP2 genes encoding metallothionein-I and metallothionein-II. Nucleotide (GenBank) : KC585416 Large subunit ribosomal RNA gene, partial sequence Nucleotide (GenBank) : LJBI00000000 Yarrowia lipolytica strain W29, whole genome shotgun sequencing project |
| References | Maldonado P, Charpentier M. Fermentation process for the production of citric and isocitric acids. US Patent 3,997,399 dated Dec 14 1976 Gaillardin CM, et al. A study of copulation, sporulation and meiotic segregation in Candida lipolytica. Arch. Mikrobiol. 92: 69-83, 1973. PubMed: 4725824 Treton B, Heslot H. Etude de quelques proprietes de l'aconitase de la levure Saccharomycopsis lipolytica. Agric Biol Chem 42: 1201-1206, 1978. French Patent 72/41 913 Souciet JL, et al. Genomic Exploration of the Hemiascomycetous Yeasts: 1. A set of yeast species for molecular evolution studies. FEBS Lett. 487: 3-12, 2000. Casaregola S, et al. Genomic Exploration of the Hemiascomycetous Yeasts: 17. Yarrowia lipolytica. FEBS Lett. 487: 95-100, 2000. Knutsen AK, et al. Polyphasic re-examination of Yarrowia lipolytica strains and the description of three novel Candida species: Candida oslonensis sp. nov., Candida alimentaria sp. nov. and Candida hollandica sp. nov. Int. J. Syst. Evol. Microbiol. 57: 2426-2435, 2007. PubMed: 17911320 Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009. PubMed: 19664262 Fickers P, et al. Identification and characterisation of LIP7 and LIP8 genes encoding two extracellular triacylglycerol lipases in the yeast Yarrowia lipolytica. Fungal Genet. Biol. 42: 264-274, 2005. PubMed: 15707847 Butler G, et al. Evolution of the MAT locus and its Ho endonuclease in yeast species. Proc. Natl Acad. Sci. USA 101: 1632-1637, 2004. PubMed: 14745027 Casaregola S, et al. Ylli, a non-LTR retrotransposon L1 family in the dimorphic yeast Yarrowia lipolytica. Mol. Biol. Evol. 19: 664-677, 2002. PubMed: 11961100 Kerscher S, et al. The complete mitochondrial genome of Yarrowia lipolytica. Comp. Funct. Genomics 2: 80-90, 2001. PubMed: 18628906 Mauersberger S, et al. Insertional mutagenesis in the n-alkane-assimilating yeast Yarrowia lipolytica: generation of tagged mutations in genes involved in hydrophobic substrate utilization. J. Bacteriol. 183: 5102-5109, 2001. PubMed: 11489863 Richard M, et al. Tagging morphogenetic genes by insertional mutagenesis in the yeast Yarrowia lipolytica. J. Bacteriol. 183: 3098-3107, 2001. PubMed: 11325938 Vernis L, et al. Only centromeres can supply the partition system required for ARS function in the yeast Yarrowia lipolytica. J. Mol. Biol. 305: 203-217, 2001. PubMed: 11124900 Pomraning KR, Baker SE. Draft genome sequence of the dimorphic yeast Yarrowia lipolytica strain W29. Genome Announc 3: e01211-15, 2015. PubMed: 26607882 Gaillardin CM, et al. A study of copulation, sporulation and meiotic segregation in Candida lipolytica. Arch. Mikrobiol. 92: 69-83, 1973. PubMed: 4725824 |
| 梅經理 | 17280875617 | 1438578920 |
| 胡經理 | 13345964880 | 2438244627 |
| 周經理 | 17757487661 | 1296385441 |
| 于經理 | 18067160830 | 2088210172 |
| 沈經理 | 19548299266 | 2662369050 |
| 李經理 | 13626845108 | 972239479 |
