| 產品名稱 |
Aspergillus flavus Link |
| 商品貨號 |
B183002 |
| Deposited As |
Aspergillus parasiticus |
| Strain Designations |
FGSC A1244 |
| Application |
aflatoxin research |
| Biosafety Level |
1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format |
frozen |
| Storage Conditions |
Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Genotype |
Delta ku70 Delta pyrG |
| Preceptrol® |
no |
| Morphology |
After 7 days on Potato dextrose agar at 25°C, colonies olive-green, flat, powdery, mycelium white, reverse uncolored. Conidial heads radiate; stipes rough-walled, hyaline; vesicles pyriform, uniseriate. Conidia globose, smooth-walled, green. |
| Medium |
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 323: Malt agar medium
ATCC® Medium 336: Potato dextrose agar (PDA)
|
| Growth Conditions |
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic |
| Sequenced Data |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
AAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCGTGGCCGCCGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCAATCTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG
|
| Name of Depositor |
FGSC |
| Chain of Custody |
ATCC <-- FGSC <-- Chang PK |
| Isolation |
Derived from aflatoxigenic Aspergillus flavus strain CA14 |
| References |
Chang PK, Horn BW, Dorner JW. Clustered genes involved in cyclopiazonic acid production are next to the aflatoxin biosynthesis gene cluster in Aspergillus flavus. Fungal Genet. Biol. 46: 176-182, 2009. PubMed: 19038354
|