Restriction digests of the clone give the following sizes (kb): XbaI/HindIII--2.95, 1.3; BglII--4.2; SmaI--4.2; SacI--3.4, 0.8; PvuII--2.6, 1.6. The insert includes the following restriction sites (approximate kb from the 5' end): BglII--0.13, SmaI--0.22; SacI--0.5; XmnI--0.7; PvuII--1.19, 1.22. Contains the complete coding sequence, corresponding to nt 611-1843 of the sequence record. The 5' oligonucleotide sequence was chosen to start with the second ATG codon. It is therefore possible that the region encoding two additional amino terminal amino acids was not amplified using these oligonucleotides. Amplified from mRNA pooled from mouse embryos and 3 different cell lines using ATG-containing [5' ATGCACTTGCAAAGGGCTCTG 3'] and TGA complement-containing oligonucleotides [5' CCCGTTAACTCAGCTGCACTTGCAGGA 3']. Transcription from the T3 promoter gives the sense strand. |
