| 產品名稱 | Paracoccidioides lutzii Teixeira et al. |
|---|---|
| 商品貨號 | B175851 |
| Deposited As | Paracoccidioides brasiliensis (Splendore) Almeida |
| Strain Designations | Pb01 [01] |
| Application | RAPD analysis Biomedical Research and Development Material |
| Biosafety Level | 2
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format | frozen |
| Storage Conditions | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain | yes |
| Preceptrol® | no |
| Genome Sequenced Strain | Yes |
| Comments | Highly virulent
Differential expression of proteins PbY20 (by yeast form) and PbM46 (by mycelial form)
Protein synthesis patterns
Effect of amphotericin B
Expression of gp43
Differential expression of gene for heat shock protein, Hsp70
RAPD analysis
Genome sequencing strain (University of Brasil, Brasil).
This fungus was previously known as Paracoccidioides brasiliensis
Growth is restricted and heaped on all media and is most robust on Rabbit Blood agar. This strain does not grow well in broth. |
| Medium | ATCC® Medium 28: Emmons' modification of Sabouraud's agar ATCC® Medium 4: Rabbit blood agar ATCC® Medium 709: 1/10 BHIV agar medium |
| Growth Conditions | Temperature: 35°C to 37°C Atmosphere: Typical aerobic |
| Sequenced Data |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28/26S ribosomal RNA gene, partial sequence AAGGATCATTAACGCGCCGTGGGGGGACGGGGCCCGATCGGGTTCCCCGACCCTCTCACCTGGCCACCCTTGTCTATCCTACCTGTTGCTTCGGCGGGCCTGCAGCGATGCTGCCGGGGGGGCTTGGCCTCCCGGGCTCGTGCCCGCCGGGGACACCGTTGAACTTCTGGTTCGGAGCTTTGACGTCTGAGACCCATCATAATCAGTGAAAACTTTCAACAACGGATCTCTTGGTTCCGACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCAAGCGCGGCTTGTGTGTTGGGCCCGCGTCCCCCCATGGACGTGCCCGAAAAGCAGCGGCGGCGTCGCGTTCCGGTGCCCGAGCGTATGGGGCTTCGTCACACGCTCTCAGAGGCCCGGCCGGCCCCGGCCCCCACTCATCGACCCCGGCGGGGGGGAAAGTAAGTCTTCTCTCGACATCTTCCCCTCTTCCGACCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG D1D2 region of the 28/26S ribosomal RNA gene CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCTCCTTTGGGGCCCGAGTTGTAATTTGTAGAGGATGCTTCGGGCGTGGCCGCGGTCTAAGTCCCCTGGAACGGGGCGTCGCAGAGGGTGAGAATCCCGTCTTCGGCCGGCCGGCCCCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGTCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGAGTCGGCCGCGGGGGCTCAGCGGGCACTTGTTGCCCGTGCACTCCCCCGTGGTCGGGCCAGCGTCGGTTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGCCTCTCGGGGCGTCTTATAGCCGGGGGTGCAATGCGGCCAGTCGGGACCGAGGAACGCGCTCCGGCACGGACGCTGGCTTAATGGTTGTAAGCGA |
| Name of Depositor | CM Soares |
| Special Collection | NCRR Contract |
| Chain of Custody | ATCC <-- CM Soares <-- M.R.R. Silva 01 |
| Isolation | Clinical isolate, Goiania, Brazil |
| Cross References | Nucleotide (GenBank) : AF148715 glucan synthase (FKS) gene, complete coding sequence Nucleotide (GenBank) : U91560 heat shock protein 70 gene, hsp70, complete coding sequence Nucleotide (GenBank) : ABKH00000000 Paracoccidioides lutzii Pb01, whole genome shotgun sequencing project |
| References | Teixeira Mde M, et al. Paracoccidioides lutzii sp. nov.: biological and clinical implications. Med Mycol 52: 19-28, 2014. PubMed: 23768243 Paes HC, et al. Characterisation of the heat shock factor of the human thermodimorphic pathogen Paracoccidioides lutzii. Fungal Genet Biol 48: 947-955, 2011. PubMed: 21708278 Desjardins CA, et al. Comparative genomic analysis of human fungal pathogens causing paracoccidioidomycosis. PLoS Genet 7: e1002345, 2011. PubMed: 22046142 Glenn AE, et al. Comparative genomic and phylogenetic investigation of the xenobiotic metabolizing arylamine N-acetyltransferase enzyme family. FEBS Lett 584: 3158-3164, 2010. PubMed: 20621844 Teixeira MM, et al. Phylogenetic analysis reveals a high level of speciation in the Paracoccidioides genus. Mol Phylogenet Evol 52: 273-283, 2009. PubMed: 19376249 Rosenblad MA, et al. Kinship in the SRP RNA family. RNA Biol. 6: 508-516, 2009. PubMed: 19838050 Theodoro RC, Bagagli E, Oliveira C. Phylogenetic analysis of PRP8 intein in Paracoccidioides brasiliensis species complex. Fungal Genet Biol 45: 1284-1291, 2008. PubMed: 18672080 Derengowski LS, et al. Upregulation of glyoxylate cycle genes upon Paracoccidioides brasiliensis internalization by murine macrophages and in vitro nutritional stress condition. Med Mycol 46: 125-134, 2008. PubMed: 18324491 Dantas AS, et al. Oxidative stress response in Paracoccidioides brasiliensis: assessing catalase and cytochrome c peroxidase. Mycol Res 112: 747-756, 2008. PubMed: 18499421 Fernandes L, et al. Transcriptional profile of ras1 and ras2 and the potential role of farnesylation in the dimorphism of the human pathogen Paracoccidioides brasiliensis. FEMS Yeast Res 8: 300-310, 2008. PubMed: 17927766 Pereira M, et al. Molecular cloning and characterization of a glucan synthase gene from the human pathogenic fungus Paracoccidioides brasiliensis. Yeast 16: 451-462, 2000. PubMed: 10705373 Cunha AF, et al. Identification, N-terminal region sequencing and similarity analysis of differentially expressed proteins in Paracoccidioides brasiliensis. Med. Mycol. 37: 115-121, 1999. PubMed: 10361267 Molinari-Madlum EE, et al. Virulence of Paracoccidioides brasiliensis isolates can be correlated to groups defined by random amplified polymorphic DNA analysis. Med. Mycol. 37: 269-276, 1999. PubMed: 10421862 da Silva SP, et al. Differential expression of an hsp70 gene during transition from the mycelial to the infective yeast form of the human pathogenic fungus Paracoccidioides brasiliensis. Mol. Microbiol. 31: 1039-1050, 1999. PubMed: 10096073 Salem-Izacc SM, et al. Protein synthesis patterns of Paracoccidioides brasiliensis isolates in stage-specific forms and during cellular differentiation. J. Med. Vet. Mycol. 35: 205-211, 1997. Jesuino RS, et al. In vitro amphotericin B effects on growth, viability and dimorphism of Paracoccidioides brasiliensis: reversal of the treatment. Microbiol. Immunol. 41: 93-99, 1997. PubMed: 9087951 Mattar-Filho R, et al. Expression of glycoprotein gp43 in stage-specific forms and during dimorphic differentiation of Paraccidioides brasiliensis. J. Med. Vet. Mycol. 35: 341-345, 1997. Soares CM, et al. Characterization of Paracoccidioides brasiliensis isloates by random amplified polymorphic DNA analysis. J. Clin. Microbiol. 33: 505-507, 1995. PubMed: 7714219 da Silva SP, et al. Phase transition and stage-specific protein synthesis in the dimorphic fungus Paracoccidioides brasiliensis. Exp. Mycol. 18: 294-299, 1994. Celia M Soares, personal communication Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009. PubMed: 19664262 Nicola AM, et al. The stress responsive and morphologically regulated hsp90 gene from Paracoccidioides brasiliensis is essential to cell viability. BMC Microbiol 8: 158, 2008. PubMed: 18808717 Carrero LL, et al. New Paracoccidioides brasiliensis isolate reveals unexpected genomic variability in this human pathogen. Fungal Genet Biol 45: 605-612, 2008. PubMed: 18364259 Bastos KP, et al. The transcriptome analysis of early morphogenesis in Paracoccidioides brasiliensis mycelium reveals novel and induced genes potentially associated to the dimorphic process. BMC Microbiol 7: 29-29, 2007. PubMed: 17425801 Bailao AM, et al. The transcriptional profile of Paracoccidioides brasiliensis yeast cells is influenced by human plasma. FEMS Immunol Med Microbiol 51: 43-57, 2007. PubMed: 17608708 Bailao AM, et al. Differential gene expression by Paracoccidioides brasiliensis in host interaction conditions: Representational difference analysis identifies candidate genes associated with fungal pathogenesis. Microbes Infect 8: 2686-2697, 2006. PubMed: 16962356 Andersen ES, et al. The tmRDB and SRPDB resources. Nucleic Acids Res. 34: D163-D168, 2006. PubMed: 16381838 Castro Nda S, et al. Screening for glycosylphosphatidylinositol-anchored proteins in the Paracoccidioides brasiliensis transcriptome. Genet Mol Res 4: 326-345, 2005. PubMed: 16110449 Felipe MS, et al. Transcriptional profiles of the human pathogenic fungus Paracoccidioides brasiliensis in mycelium and yeast cells. J Biol Chem 280: 24706-24714, 2005. PubMed: 15849188 Albuquerque P, et al. Pbhyd1 and Pbhyd2: two mycelium-specific hydrophobin genes from the dimorphic fungus Paracoccidioides brasiliensis. Fungal Genet Biol 41: 510-520, 2004. PubMed: 15050540 Felipe MS, et al. Transcriptome characterization of the dimorphic and pathogenic fungus Paracoccidioides brasiliensis by EST analysis. Yeast 20: 263-271, 2003. PubMed: 12557278 Izacc SM, et al. Molecular cloning, characterization and expression of the heat shock protein 60 gene from the human pathogenic fungus Paracoccidioides brasiliensis. Med Mycol 39: 445-455, 2001. PubMed: 12054056 Motoyama AB, et al. Molecular identification of Paracoccidioides brasiliensis by PCR amplification of ribosomal DNA. J Clin Microbiol 38: 3106-3109, 2000. PubMed: 10921990 |
| 梅經理 | 17280875617 | 1438578920 |
| 胡經理 | 13345964880 | 2438244627 |
| 周經理 | 17757487661 | 1296385441 |
| 于經理 | 18067160830 | 2088210172 |
| 沈經理 | 19548299266 | 2662369050 |
| 李經理 | 13626845108 | 972239479 |
