| 產品名稱 |
Malassezia dermatis Sugita et al. |
| 商品貨號 |
B172436 |
| Deposited As |
Malassezia dermatis |
| Strain Designations |
CBS 9169 [JCM 11348, M 9927] |
| Biosafety Level |
2
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format |
frozen |
| Storage Conditions |
Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section |
| Type Strain |
yes |
| Preceptrol® |
no |
| Genome Sequenced Strain |
Yes
|
| Comments |
Lipophilic or lipid-dependent yeasts
Biomedical strain
Genome sequencing strain (Genome Institute of Singapore, Singapore; RIKEN Center for Life Science Technologies, Japan) |
| Morphology |
After 3 days on Leeming & Notman agar at 30°C, colonies are cream-colored, smooth, butyrous, dull. Cells are globose, subglobose or ovoidal; pseudohyphae not observed. |
| Medium |
ATCC® Medium 2693: modified Dixon (mDixon)
ATCC® Medium 2737: Modified Leeming & Notman Agar (MLNA)
|
| Growth Conditions |
Temperature: 30°C to 32°C
Atmosphere: Typical aerobic |
| Sequenced Data |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
AAGGATCATTAGTGAAGATTTGGGCCAGCCATACGGACGCTACCGCGTCTCTGGCGCCCACCACTATATCCACACCAACCCCTGTGCACTGTGATGGCGAAAGTCATCGAACCAAAAAAACTCGTATGGTTGTATGTACGTGAAACTGTAGGCTTTGCCTACGAACTATACACAACTTTCGACAACGGATCTCTTGGTTCTCCCATCGATGAAGAACGCAGCGAAACGCGATAGGTAATGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCACCTTGCGCTCCATGGTATTCCGTGGAGCATGCCTGTTTGAGTGCCGCGAATTCTCCCTCCCCATACGGTGGCCGAAAGGCCGGAGTATGGCGGACGGGGTTGGATGGGTGCCGCTGCCTGGGAAACCAGGCTCGCCCGAAATGCATAAGCGCCAGGACCCTCGCTACTGCCCTCTAGGGAAGGGCGGCTGAGCGACCGCTGAGCATGGCATGATACGTCATTTGCTGTGTGTGGGCGGCCGGTTGGAGAGGTGTCTGCTTTATACAGCCCTTTTTATTCTGGTCTCAAATCAGGTAGGATCACCCGCTGAACTTAAG
|
| Name of Depositor |
CBS |
| Chain of Custody |
ATCC <-- CBS <-- JCM <-- Sugita T |
| Isolation |
Skin lesions of adult patient, Tokyo, Japan |
| Cross References |
Nucleotide (GenBank) :
BCKX00000000
Malassezia dermatis strain JCM 11348, whole genome shotgun sequencing project
|
| References |
Sugita T, et al. New yeast species, Malassezia dermatis, isolated from patients with atopic dermatitis. J. Clin. Microbiol. 40(4): 1363-1367, 2002. PubMed: 11923357
Caba?es FJ, et al. Two New lipid-dependent Malassezia species from domestic animals. FEMS Yeast Res. 7(6): 1064-1076, 2007. PubMed: 17367513
Gaitanis G, Robert V, Velegraki A. Verifiable single nucleotide polymorphisms of the internal transcribed spacer 2 region for the identification of 11 Malassezia species. J. Dermatol. Sci. 43(3): 214-217, 2006. PubMed: 16797927
Castellá G, Coutinho SD, Caba?es FJ. Phylogenetic relationships of Malassezia species based on multilocus sequence analysis. Med. Mycol. 52: 99-105, 2014. PubMed: 23902157
Wang QM, et al. Multigene phylogeny and taxonomic revision of yeasts and related fungi in the Ustilaginomycotina. Stud. Mycol. 81: 55-83, 2015. PubMed: 26955198
|
