| Comments |
Restriction digests of the clone give the following sizes (kb): EcoRI--22.6, 12.5, 6.2, 3.8, 1.95, 1.60; EcoRI/HindIII--22.6, 12.5, 4.0, 3.0, 1.95, 1.60 (doublet), 0.44, 0.26. Verified to contain the correct insert sequence using the following oligonucleotides (5'-3'): CGGTGTTTCAGCCAGAGCTCCCAC and CCTATACTTAACGGAGGCCAGCCAC. The predicted product size is (bp): 247. The observed product size is (bp): 250. |
| References |
Bray P, et al. Characterization and mapping of human genes encoding zinc finger proteins. Proc. Natl. Acad. Sci. USA 88: 9563-9567, 1991. PubMed: 1946370
Lichter P, et al. Clustering of C2-H2 zinc finger motif sequences within telomeric and fragile site regions of human chromosomes. Genomics 13: 999-1007, 1992. PubMed: 1505991
|