| 產品名稱 | Aspergillus nidulans (Eidam) Winter |
|---|---|
| 商品貨號 | B166695 |
| Strain Designations | G00 [ATCC 12996, ATCC 26451, C. Thom 5616.1, CBS 112.46, FGSC A4, Glasgow wild-type, Pontecorvo strain, IMI 38576ii, NRRL 194, SRRC 273, WB 194, Yuill A69, biA-1] |
| Alternate State | Emericella nidulans (Eidam) Vuillemin |
| Application | Produces ferricrocin Produces triacetylfusigen Transformation host |
| Biosafety Level | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format | freeze-dried |
| Storage Conditions | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain | no |
| Genotype | argB |
| Preceptrol® | no |
| Genome Sequenced Strain | Yes |
| Ploidy | haploid |
| Comments | Biotin-dependent as standard wild type for most purposes Genome sequencing strain (Broad Institute, USA; Nagoya University, Japan; Joint Genome Institute, Department of Energy, USA) |
| Morphology | On PDA medium at 25°C after 6 days, mycelium buff to cinnamon brown becoming army green as conidia develop, velutinous. Reverse tan to reddish brown becoming dark reddish brown. Hyphae hyaline with some stained dark red, guttulate. Conidia globose to subglobose, green, roughened, 4.5-6 X 4.5 μm. |
| Medium | ATCC® Medium 324: Malt extract agar ATCC® Medium 325: Malt extract agar (Blakeslee's formula) ATCC® Medium 336: Potato dextrose agar (PDA) |
| Growth Conditions | Temperature: 20°C to 25°C
Atmosphere: Typical aerobic |
| Sequenced Data |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGCTGCCTCCGGGCGCCCAACCTCCCACCCGTGACTACCTAACACTGTTGCTTCGGCGGGGAGCCCCCCAGGGGCGAGCCGCCGGGGACCACTGAACTTCATGCCTGAGAGTGATGCAGTCTGAGCCTGAATACAAATCAGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAACTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGTCGTCCCCCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGTGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCGATTAGGGCCGGCCGGGCGCCAGCCGGCGTCTCCAACCTTATTTTTCTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA D1D2 region of the 28S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCCCCTTCGGGGTCCGCGTTGTAATTTGCAGAGGATGCTTCGGGTGCGGCCCCTGTCTAAGTGCCCTGGAACGGGCCGTCAGAGAGGGTGAGAATCCCGTCTTGGGCAGGGTGCCCGTGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACCGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGGCCCCGGGGTTCAGCCAGCACTCGTGCTGGTGTACTTCCCCGGGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCCCAGGAATGTATCGCCCTCCGGGGTTGTCTTATAGCCTGGGGTGCAATGCGGCCAGCCCGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCGTAATGGTCGCAAACGAC Calmodulin (CAL) TATTTGTAAGTGCCATTGGTTACTGTTATATCAAAATCGAATTTGTATTGAGAGTATACTAATACATTCCGCACTAAACAGGACAAGGATGGCGATGGTTAGTGCATCTGTCCCCCCAGGCTTGATCGCATTCGCCCAGCATGTCTGCTGTAGCTCTATATAACCGTTTCTGACAAACGGCGACAGGCCAGATTACCACTAAGGAGCTTGGCACTGTCATGCGCTCGCTCGGTCAGAATCCTTCAGAGTCTGAGCTTCAGGACATGATCAACGAAGTTGACGCCGACAACAATGGCACCATTGACTTTCCAGGTACGCGAACTCCCCAATCTACTTCGCACCAGCCTAGAAATGTACTAATGCTAAACAGAGTTCCTTA |
| Name of Depositor | AJ Clutterbuck |
| Cross References | Nucleotide (GenBank) : HQ026740 ITS including 5.8S rRNA gene Nucleotide (GenBank) : KU729132 D1/D2 region of 28S rRNA gene Nucleotide (GenBank) : KU933409 calmodulin gene Nucleotide (GenBank) : AACD00000000 Aspergillus nidulans FGSC A4, whole genome shotgun sequencing project |
| References | Charlang G, et al. Cellular and extracellular siderophores of Aspergillus nidulans and Penicillium chrysogenum. Mol. Cell. Biol. 1: 94-100, 1981. PubMed: 6242827 Pontecorvo G, et al. The genetics of Aspergillus nidulans. Adv. Genet. 5: 142-238, 1953. Zonneveld BJ. Inhibitory effect of 2-Deoxyglucose on cell wall alpha-1,3-glucan synthesis and cleistothecium development in Aspergillus nidulans. Dev. Biol. 34: 1-8, 1973. PubMed: 4595497 Dorn GL. A revised map of the eight linkage groups of Aspergillus nidulans. Genetics 56: 619-631, 1967. PubMed: 6061654 Lin WL, et al. Kinetics of cell growth and heterologous glucoamylase production in recombinant Aspergillus nidulans. Biotechnol. Bioeng. 41: 273-279, 1993. Timberlake WE. Low repetitive DNA content in Aspergillus nidulans. Science 202: 973-975, 1978. PubMed: 362530 Yadwad VB, et al. Effect of culture conditions and induction strategies on production of human interleukin-6 by a recombinant Aspergillus nidulans strain. Mycol. Res. 100: 356-360, 1996. Galagan JE, et al. Sequencing of Aspergillus nidulans and comparative analysis with A. fumigatus and A. oryzae. Nature 438: 1105-1115, 2005. PubMed: 16372000 Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009. PubMed: 19664262 Kuprys PV, et al. Identification of telomerase RNAs from filamentous fungi reveals conservation with vertebrates and yeasts. PLoS One 8: e58661, 2013. PubMed: 23555591 Qi X, et al. The common ancestral core of vertebrate and fungal telomerase RNAs. Nucleic Acids Res. 41: 450-462, 2013. PubMed: 23093598 Stajich JE, et al. Insights into evolution of multicellular fungi from the assembled chromosomes of the mushroom Coprinopsis cinerea (Coprinus cinereus). Proc Natl Acad Sci USA. 107(26): 11889-11894, 2010. PubMed: 20547848 Glenn AE, et al. Comparative genomic and phylogenetic investigation of the xenobiotic metabolizing arylamine N-acetyltransferase enzyme family. FEBS Lett 584: 3158-3164, 2010. PubMed: 20621844 Min IS, et al. Differential expression of citA gene encoding the mitochondrial citrate synthase of Aspergillus nidulans in response to developmental status and carbon sources. J. Microbiol. 48: 188-198, 2010. PubMed: 20437151 Wortman JR, et al. The 2008 update of the Aspergillus nidulans genome annotation: a community effort. Fungal Genet Biol 46: S2-13, 2009. PubMed: 19146970 Apostolaki A, et al. AgtA, the dicarboxylic amino acid transporter of Aspergillus nidulans, is concertedly down-regulated by exquisite sensitivity to nitrogen metabolite repression and ammonium-elicited endocytosis. Eukaryot Cell 8: 339-352, 2009. PubMed: 19168757 Paoletti M, et al. Mating type and the genetic basis of self-fertility in the model fungus Aspergillus nidulans. Curr. Biol. 17: 1384-1389, 2007. PubMed: 17669651 Ganley AR, Kobayashi T. Highly efficient concerted evolution in the ribosomal DNA repeats: total rDNA repeat variation revealed by whole-genome shotgun sequence data. Genome Res. 17: 184-191, 2007. PubMed: 17200233 Flipphi M, et al. Functional analysis of alcS, a gene of the alc cluster in Aspergillus nidulans. Fungal Genet. Biol. 43: 247-260, 2006. PubMed: 16531087 Chang MH, et al. The GanB Galpha-protein negatively regulates asexual sporulation and plays a positive role in conidial germination in Aspergillus nidulans. Genetics 167: 1305-1315, 2004. PubMed: 15280244 Ram AF, et al. The cell wall stress response in Aspergillus niger involves increased expression of the glutamine : fructose-6-phosphate amidotransferase-encoding gene (gfaA) and increased deposition of chitin in the cell wall. Microbiology 150: 3315-3326, 2004. PubMed: 15470111 Clutterbuck AJ. MA TE transposable elements in Aspergillus nidulans: evidence of repeat-induced point mutation. Fungal Genet. Biol. 41: 308-316, 2004. PubMed: 14761791 Dyer PS, Paoletti M, Archer DB. Genomics reveals sexual secrets of Aspergillus. Microbiology 149: 2301-2303, 2003. PubMed: 12949156 Kim H, et al. The veA gene activates sexual development in Aspergillus nidulans.Fungal Genet. Biol. 37: 72-80, 2002. PubMed: 12223191 Jeong HY, et al. The veA gene is necessary for the inducible expression by fructosyl amines of the Aspergillus nidulans faoA gene encoding fructosyl amino acid oxidase (amadoriase, EC 1.5.3). Arch. Microbiol. 178: 344-350, 2002. PubMed: 12375102 Jeong HY, et al. Differential expression of house-keeping genes of Aspergillus nidulans during sexual development. Gene 262: 215-219, 2001. PubMed: 11179686 Vallim MA, Miller KY, Miller BL. Aspergillus SteA (sterile12-like) is a homeodomain-C2/H2-Zn+2 finger transcription factor required for sexual reproduction. Mol. Microbiol. 36: 290-301, 2000. PubMed: 10792717 Hoffmann B, et al. Developmental and metabolic regulation of the phosphoglucomutase-encoding gene, pgmB, of Aspergillus nidulans. Mol. Gen. Genet. 262: 1001-1011, 2000. PubMed: 10660061 Eckert SE, et al. The tryptophan synthase-encoding trpB gene of Aspergillus nidulans is regulated by the cross-pathway control system. Mol. Gen. Genet. 263: 867-876, 2000. PubMed: 10905354 Pascon RC, Miller BL. Morphogenesis in Aspergillus nidulans requires Dopey (DopA), a member of a novel family of leucine zipper-like proteins conserved from yeast to humans. Mol. Microbiol. 36: 1250-1264, 2000. PubMed: 10931277 Jeong HY, et al. The rpl16a gene for ribosomal protein L16A identified from expressed sequence tags is differentially expressed during sexual development of Aspergillus nidulans. Fungal Genet. Biol. 31: 69-78, 2000. PubMed: 11170736 |
| 梅經理 | 17280875617 | 1438578920 |
| 胡經理 | 13345964880 | 2438244627 |
| 周經理 | 17757487661 | 1296385441 |
| 于經理 | 18067160830 | 2088210172 |
| 沈經理 | 19548299266 | 2662369050 |
| 李經理 | 13626845108 | 972239479 |

